KaneAI - World’s First E2E Software Testing Agent.Book a Demo Join TestMu Conference

How to use seq method in fMBT

Best Python code snippet using fMBT_python

DatasetTest.py

Source:DatasetTest.py

1from torch.utils.data import Dataset2import numpy as np3import os4class DatasetTest(Dataset):5    def __init__(self, dataset_path, action_type, postex, global_max, global_min):6        super(DatasetTest, self).__init__()7        self.dataset_path = dataset_path + action_type + postex8        self.seq_45 = np.load(self.dataset_path)9        self.seq_45 = np.transpose(self.seq_45, (0, 2, 1))10        11        self.global_max = global_max12        self.global_min = global_min13        # Normalize14        self.seq_45 = (self.seq_45 - self.global_min) / (self.global_max - self.global_min)15        self.seq_45 = self.seq_45 * 2 - 116        # self.seq_pre_10 = self.seq_45[:, :10, :]17        # self.seq_mid_25 = self.seq_45[:, 10:35, :]18        # self.seq_post_10 = self.seq_45[:, 35:, :]19        # self.seq_pre_10 = self.seq_45[:, 9:10, :]20        # self.seq_mid_25 = self.seq_45[:, 10:35, :]21        # self.seq_post_10 = self.seq_45[:, 35:36, :]22        # self.seq_pre_10 = self.seq_45[:, 5:10, :]23        # self.seq_mid_25 = self.seq_45[:, 10:35, :]24        # self.seq_post_10 = self.seq_45[:, 35:40, :]25        # last_x = self.seq_45[:, 9, :]26        # first_z = self.seq_45[:, 35, :]27        #5_25_528        # self.seq_pre_10 = self.seq_45[:, :5, :]29        # self.seq_mid_25 = self.seq_45[:, 5:30, :]30        # self.seq_post_10 = self.seq_45[:, 30:, :]31        # last_x = self.seq_45[:, 4, :]32        # first_z = self.seq_45[:, 30, :]33        #10_25_1034        # self.seq_pre_10 = self.seq_45[:, :10, :]35        # self.seq_mid_25 = self.seq_45[:, 10:35, :]36        # self.seq_post_10 = self.seq_45[:, 35:, :]37        # last_x = self.seq_45[:, 9, :]38        # first_z = self.seq_45[:, 35, :]39        #15_25_1040        # self.seq_pre_10 = self.seq_45[:, :15, :]41        # self.seq_mid_25 = self.seq_45[:, 15:40, :]42        # self.seq_post_10 = self.seq_45[:, 40:, :]43        # last_x = self.seq_45[:, 14, :]44        # first_z = self.seq_45[:, 40, :]45        #20_25_2046        # self.seq_pre_10 = self.seq_45[:, :20, :]47        # self.seq_mid_25 = self.seq_45[:, 20:45, :]48        # self.seq_post_10 = self.seq_45[:, 45:, :]49        # last_x = self.seq_45[:, 19, :]50        # first_z = self.seq_45[:, 45, :]51        # print(self.seq_45.shape)52        self.seq_pre_10 = self.seq_45[:, 10:20, :]53        self.seq_mid_25 = self.seq_45[:, 20:45, :]54        self.seq_post_10 = self.seq_45[:, 45:55, :]55        last_x = self.seq_45[:, 19, :]56        first_z = self.seq_45[:, 45, :]57        self.mid_resid = np.linspace(last_x, first_z, 25).transpose((1, 0, 2))58        # self.mid_repx = np.repeat(self.seq_45[:, 9:10, :], (1, 25, 1))59        # self.mid_repz = np.repeat(self.seq_45[:, 35:36, :], (1, 25, 1))60        # self.seq_pre_10 = self.seq_pre_10[:48]61        # self.seq_mid_25 = self.seq_mid_25[:48]62        # self.mid_resid = self.mid_resid[:48]63        # self.seq_post_10 = self.seq_post_10[:48]64        self.data_num = len(self.seq_pre_10)65    def __len__(self):66        return self.data_num67    def __getitem__(self, item):68        output = {69            'pre_10': self.seq_pre_10[item],70            'mid_25': self.seq_mid_25[item],71            'mid_resid': self.mid_resid[item],72            'post_10': self.seq_post_10[item],73            # 'mid_repx':self.mid_repx[item],74            # 'mid_repz': self.mid_repz[item]75        }...

DatasetTrain.py

Source:DatasetTrain.py

1from torch.utils.data import Dataset2import numpy as np3import os4class DatasetTrain(Dataset):5    def __init__(self, dataset_path, mode_name, global_max=1e20, global_min=-1e20):6        super(DatasetTrain, self).__init__()7        self.dataset_path = dataset_path8        self.seq_45 = np.load(dataset_path)9        10        if mode_name == 'train':11            self.global_max = np.max(self.seq_45)12            self.global_min = np.min(self.seq_45)13        else:14            self.global_max = global_max15            self.global_min = global_min16        # Normalize17        self.seq_45 = (self.seq_45 - self.global_min) / (self.global_max - self.global_min)18        self.seq_45 = self.seq_45 * 2 - 119        ma = np.max(self.seq_45)20        mb = np.min(self.seq_45)21        # self.seq_pre_10 = self.seq_45[:, :10, :]22        # self.seq_mid_25 = self.seq_45[:, 10:35, :]23        # self.seq_post_10 = self.seq_45[:, 35:, :]24        # self.seq_pre_10 = self.seq_45[:, 9:10, :]25        # self.seq_mid_25 = self.seq_45[:, 10:35, :]26        # self.seq_post_10 = self.seq_45[:, 35:36, :]27        # self.seq_pre_10 = self.seq_45[:, 5:10, :]28        # self.seq_mid_25 = self.seq_45[:, 10:35, :]29        # self.seq_post_10 = self.seq_45[:, 35:40, :]30        # last_x = self.seq_45[:, 9, :]31        # first_z = self.seq_45[:, 35, :]32        #5_25_533        # self.seq_pre_10 = self.seq_45[:, :5, :]34        # self.seq_mid_25 = self.seq_45[:, 5:30, :]35        # self.seq_post_10 = self.seq_45[:, 30:, :]36        # last_x = self.seq_45[:, 4, :]37        # first_z = self.seq_45[:, 30, :]38        #10_25_1039        # self.seq_pre_10 = self.seq_45[:, :10, :]40        # self.seq_mid_25 = self.seq_45[:, 10:35, :]41        # self.seq_post_10 = self.seq_45[:, 35:, :]42        # last_x = self.seq_45[:, 9, :]43        # first_z = self.seq_45[:, 35, :]44        #15_25_1545        # self.seq_pre_10 = self.seq_45[:, :15, :]46        # self.seq_mid_25 = self.seq_45[:, 15:40, :]47        # self.seq_post_10 = self.seq_45[:, 40:, :]48        # last_x = self.seq_45[:, 14, :]49        # first_z = self.seq_45[:, 40, :]50        #20_25_2051        # self.seq_pre_10 = self.seq_45[:, :20, :]52        # self.seq_mid_25 = self.seq_45[:, 20:45, :]53        # self.seq_post_10 = self.seq_45[:, 45:, :]54        # last_x = self.seq_45[:, 19, :]55        # first_z = self.seq_45[:, 45, :]56        self.seq_pre_10 = self.seq_45[:, 10:20, :]57        self.seq_mid_25 = self.seq_45[:, 20:45, :]58        self.seq_post_10 = self.seq_45[:, 45:55, :]59        last_x = self.seq_45[:, 19, :]60        first_z = self.seq_45[:, 45, :]61        self.mid_resid = np.linspace(last_x, first_z, 25).transpose((1, 0, 2))62        # self.mid_resid = np.repeat(self.seq_45[:, 9:10, :], (1, 25, 1))63        self.data_num = len(self.seq_post_10)64    def __len__(self):65        return self.data_num66    def __getitem__(self, item):67        output = {68            'pre_10': self.seq_pre_10[item],69            'mid_25': self.seq_mid_25[item],70            'mid_resid': self.mid_resid[item],71            'post_10': self.seq_post_10[item]72        }...

strand-guess.py

Source:strand-guess.py

1#! /usr/bin/env python32def strand_guess(aligner, q, t, minpct=50):3    """Guess the strand of t (target) that q (query) lies on.4    Given a Bio.Align aligner and two Bio.SeqRecords q and t, guess which strand5    of t that q lies on. The approach is to align both q and q.reverse_complement()6    to t, seeing which scores higher. The score has to be at least minpct of the7    maximum possible score, default 50 percent.8    ARGUMENTS9    aligner:   A Bio.Align aligner.10    q:         Query sequence as a Bio.SeqRecord.11    t:         Target sequence as a Bio.SeqRecord.12    minpct:    Score of best alignment between q and t must be at least minpct13               percent of the maximum possible score.14    RETURNS15    > 0:       q appears to lie on the forward strand of t.16    < 0:       q appears to lie on the reverse strand of t.17    otherwise: unable to determine which strand of t.18    """19    score_max = min(aligner.score(t.seq, t.seq), aligner.score(q.seq, q.seq))20    score_f = aligner.score(q.seq, t.seq)21    score_r = aligner.score(q.reverse_complement().seq, t.seq)22    if score_f > score_r and score_f >= minpct * score_max / 100:23        return 124    elif score_r > score_f and score_r >= minpct * score_max / 100:25        return -126    else:27        return 028if __name__ == "__main__":29    # Do a few checks30    from Bio import Align31    from Bio.Seq import Seq32    from Bio.SeqRecord import SeqRecord33    aligner = Align.PairwiseAligner()34    aligner.mode = "global"35    # x aligns with the forward strand of y with a small insertion36    x = SeqRecord(37        Seq("CATCAAGCCCTGTGAGCTGAAAAACTTAGCCGGGGACAATGGAGGTGCTGGGTTTGGTGGATATTCCGACATG")38    )39    y = SeqRecord(Seq("GCTGAACTTAGCCGGGGACAATG"))40    print(f"Test 1: Got {strand_guess(aligner, x, y)}, expecting 1")41    # x aligns with the forward strand of y with a small insertion42    x = SeqRecord(Seq("GCTGAACTTAGCCGGGGACAATG"))43    y = SeqRecord(44        Seq("CATCAAGCCCTGTGAGCTGAAAAACTTAGCCGGGGACAATGGAGGTGCTGGGTTTGGTGGATATTCCGACATG")45    )46    print(f"Test 2: Got {strand_guess(aligner, x, y)}, expecting 1")47    # x aligns with the reverse strand of y with a small insertion48    x = SeqRecord(49        Seq("CATGTCGGAATATCCACCAAACCCAGCACCTCCATTGTCCCCGGCTAAGTTTTTCAGCTCACAGGGCTTGATG")50    )51    y = SeqRecord(Seq("GCTGAACTTAGCCGGGGACAATG"))52    print(f"Test 3: Got {strand_guess(aligner, x, y)}, expecting -1")53    # x aligns with the reverse strand of y with a small insertion54    x = SeqRecord(Seq("GCTGAACTTAGCCGGGGACAATG"))55    y = SeqRecord(56        Seq("CATGTCGGAATATCCACCAAACCCAGCACCTCCATTGTCCCCGGCTAAGTTTTTCAGCTCACAGGGCTTGATG")57    )...

Automation Testing Tutorials

Learn to execute automation testing from scratch with LambdaTest Learning Hub. Right from setting up the prerequisites to run your first automation test, to following best practices and diving deeper into advanced test scenarios. LambdaTest Learning Hubs compile a list of step-by-step guides to help you be proficient with different test automation frameworks i.e. Selenium, Cypress, TestNG etc.