KaneAI - World’s First E2E Software Testing Agent.Book a Demo Join TestMu Conference

How to use openen method in SeleniumBase

Best Python code snippet using SeleniumBase

openen.py

Source:openen.py

...120    fasta_df.set_index('Accession',inplace=True)121    fasta_df = fasta_df[fasta_df.Sequence != '']122    final_df = fasta_df.dropna()123    return final_df124def openen(W, u, seq):125    w_par = '-W ' + str(W)126    u_par = '-u ' + str(u)127    run(['RNAplfold', w_par, u_par, '-O'], input=str.encode(seq))128def parse_openen(l, n, i, f):129    d = pd.read_csv(f, sep='\t', skiprows=2, header=None)[l][n+i-1]130    return f.replace('_openen',''), d131def stack_openen(n, t, f):132    seqname = f.replace('_openen', '').split()133    seqname = pd.DataFrame(seqname)134    seqname.columns = ['id']135    d = pd.read_csv(f, sep='\t', skiprows=2, nrows=(n+t), header=None) #read in 5UTR length + t lines136    d = d.set_index(0).stack().to_frame()137    d = d[0].apply(lambda x: round(x, 4)).to_list()138    d = pd.DataFrame(d).T139    d = pd.concat([seqname,d], axis=1)140    return d141        142def main():143    base,ext = os.path.splitext(s)144    if ext.lower() in ('.fasta', '.fa', '.fas', '.fna'):145        seq = fasta_to_dataframe(s).reset_index()146    else:147        seq = pd.read_csv(s)148        seq.columns = ['Accession','Sequence']149        seq['Accession'] = '>' + seq['Accession']150    startTime = datetime.now()151    label = (z for z in cycle(list(range(0,p))))152    label = pd.DataFrame({'label': list(islice(label, len(seq)))})153    df = pd.concat([label, seq], axis=1)154    _openen = (df['Accession'].str.replace('>', '') + '_openen').tolist()155    if x is True:156        print('\nRunning RNAplfold using', p, 'processes...')157        print_time()158        159        if U is None:160            utr = 'GGGGAATTGTGAGCGGATAACAATTCCCCTCTAGAAATAATTTTGTTTAACTTTAAGAAGGAGATATACAT'161            df['fasta'] = df['Accession'] + '\n' + utr + seq['Sequence'] + '\n'162            fasta = df.groupby('label')['fasta'].apply(''.join).tolist()163        else:164            try:165                int(U)166                df['fasta'] = df['Accession'] + '\n' + seq['Sequence'] + '\n'167                fasta = df.groupby('label')['fasta'].apply(''.join).tolist()168            except ValueError:     169                df['fasta'] = df['Accession'] + '\n' + U + seq['Sequence'] + '\n'170                fasta = df.groupby('label')['fasta'].apply(''.join).tolist()171        172        groups = len(fasta)173        p1 = Pool(p)174        results = []175        progress(0, groups)176        openen_func = partial(openen, W, u)177        for a in p1.imap_unordered(openen_func, fasta):178            results.append(a)179            progress(len(results), groups)180            181        _stop_timer.set()182        p1.close()183        p1.join()    184                185    else:186        print('\nSkipped RNAplfold (no option -x given!)', flush = True)  187    if S is True:188        print('\nStacking _openen files and merging')189        print_time()190        191        d = pd.DataFrame()192        progress(0, len(_openen))193        for b in _openen:194            d = pd.concat([d, stack_openen(n, t, b)], sort=True)195            progress(len(d), len(_openen))196        197        _stop_timer.set()198        filename = o + '.pkl'199        d.to_pickle(filename)200    201    else:202        print('\nSkipped stacking (no option -S given!)', flush = True)203    if e is True:204        print('\nParsing _openen files using', p, 'processes...')205        parse_func = partial(parse_openen, l, n, i)206        p2 = Pool(p)207        plfold =  p2.imap_unordered(parse_func, _openen)208        p2.close()...

parelassistantding.py

Source:parelassistantding.py

2import openeentranslate3import openlandcode4import commands5import ai.main6taal = openlandcode.openen()7print(openeentranslate.openen("nl", "upcheck"))8os.system("curl https://raw.githubusercontent.com/Abelkrijgtalles/parel-assistant/master/config/versie.txt > config/versieonline.txt")9with open(os.path.join("config", "versieonline.txt")) as versieonlinenietint:10    versieonline = int(versieonlinenietint.read())11with open(os.path.join("config", "versie.txt")) as versienietint:12    versie = int(versienietint.read())13if versieonline > versie:14    print(openeentranslate.openen(taal, "updateinstall"), "J/N")15    updateinstall = input()16    updateinstall = updateinstall.upper()17    updateinstall = updateinstall.replace(" ", "")18    if updateinstall == "J":19        print(openeentranslate.openen(taal, "isgit"), "J/N")20        isgit = input()21        isgit = isgit.upper()22        isgit = isgit.replace(" ", "")23        if isgit == "J":24            os.system("git pull")25# Wat te doen26# 4: Gui maken (MOEILIJK!!!!!!!!! en het moet wel mooi zijn)27naamgui = ""28while True:29    print(openeentranslate.openen(taal, "wat"))30    naamgui = input()31    naamgui = ai.main.main(naamgui)32    if naamgui == "SONGTEKSTEN":33        print(naamgui, openeentranslate.openen(taal, "open"))34        commands.songteksten.main()35    elif naamgui == "DATA":36        print(naamgui, openeentranslate.openen(taal, "open"))37        commands.data.main()38    elif naamgui == "FEITEN":39        print(naamgui, openeentranslate.openen(taal, "open"))40        commands.feiten.main()41    elif naamgui == "GILLEN":42        print(naamgui, openeentranslate.openen(taal, "open"))43        commands.gillen.main()44    elif naamgui == "LANDEN":45        print(naamgui, openeentranslate.openen(taal, "open"))46        commands.landen.main()47    elif naamgui == "PAASDAG":48        print(naamgui, openeentranslate.openen(taal, "open"))49        commands.paasdag.main()50    elif naamgui == "TEKENCORONA":51        print(naamgui, openeentranslate.openen(taal, "open"))52        commands.tekencorona.main()53    elif naamgui == "STOP":54        break55    elif naamgui == "NIKS":56        print(openeentranslate.openen(taal, "niks"))57    else:58        print(openeentranslate.openen(taal, "niks"))...

Automation Testing Tutorials

Learn to execute automation testing from scratch with LambdaTest Learning Hub. Right from setting up the prerequisites to run your first automation test, to following best practices and diving deeper into advanced test scenarios. LambdaTest Learning Hubs compile a list of step-by-step guides to help you be proficient with different test automation frameworks i.e. Selenium, Cypress, TestNG etc.